The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.
– The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
– 100% automation ready with only a single PCR step and without the need for normalization.
– Real-time PCR enables absolute microbial copy number quantification.
| Amplicon Size | The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. |
|---|---|
| Barcode Sequences | 10 bp barcodes, Available for download here (USA Only), or under the Documents section as “Barcode Sequences”. |
| Index Primers | Dual index (barcodes) to uniquely label samples. |
| ITS Primer Sequences | (adapters not included) ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). |
| Required Equipment | Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. |
| Sample Input | Purified microbial DNA ≤100 ng, free of PCR inhibitors. |
| Sequencing Platform | Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F. |
Order information
| Cat # | Name | Size |
|---|---|---|
| D6424-PS1 | Quick-ITS Plus NGS Library Prep Kit with Primer Set 1 | 96 rxns |
| D6426 | Quick-ITS Plus NGS Library Prep Kit | 24 rxns |
| D6424-PS2 | Quick-ITS Plus NGS Library Prep Kit with Primer Set 2 | 96 rxns |
| D6424-PS3 | Quick-ITS Plus NGS Library Prep Kit with Primer Set 3 | 96 rxns |
| D6424-PS4 | Quick-ITS Plus NGS Library Prep Kit with Primer Set 4 | 96 rxns |
Sản phẩm liên quan

Quick-16S Plus NGS Library Prep Kit (V4)
Overview The Quick-16S Plus NGS Library Prep Kit (V4) is the fastest and simplest NGS library prep targeting the V4 region of the 16S rRNA gene for high-throughput sequencing. The automation-friendly protocol utilizes a premixed amplification

Quick-16S NGS Library Prep Kit
Overview 16S rRNA sequencing is a routine technique for microbiome composition profiling. Compared to shotgun metagenomics sequencing, 16S rRNA sequencing is more cost-effective and more robust; it generally requires less input DNA and is less

Quick-16S Plus NGS Library Prep Kit (V3-V4, UDI)
Overview The Quick-16S Plus NGS Library Prep Kit (V3-V4, UDI) is the fastest and simplest NGS library prep targeting the V3-V4 region of the 16S rRNA gene for high-throughput sequencing. The automation-friendly protocol utilizes a single